Journal: Nature

Article Title: CD47 blocking antibodies restore phagocytosis and prevent atherosclerosis

doi: 10.1038/nature18935

Figure Lengend Snippet: ( a ). Cytoscape network visualization of the genes which are significantly correlated with CD47 expression in both human and murine atherosclerotic plaque reveals a high number of TNF-α-related factors (indicated in blue), including ligands, receptors, and downstream signaling factors. ( b ). PANTHER pathway analysis of those genes which were (a) significantly associated with CD47 expression in mouse and human vascular tissue and (b) have been previously associated with atherosclerosis through the STAGE study , identifies “ inflammation mediated by chemokine and cytokine signaling pathway ” as the most over-abundant pathway associated with CD47 expression in vascular tissue. ( c ). Using the Hybrid Mouse Diversity Panel (HMDP), which correlates aortic gene expression with Luminex cytokine array data of plasma samples from over 100 inbred strains of mice, we found that vascular CD47 expression is positively correlated with three inflammatory cytokines in vivo, including TNF-α, IL-2 and CXCL1. Correlation data shown for CD47 and TNF-α. ( d ). Co-expression studies confirm that TNF-α and CD47 expression are positively correlated in human carotid endarterectomy samples from the BiKE validation study. The Pearson correlation coefficient was determined assuming a Gaussian distribution and P values were determined using a two-tailed test. ( e ). Experiments with primarily cultured mouse aortic SMCs indicate that TNF-α reproducibly induces CD47 mRNA upregulation, while a number of other classical pro-atherosclerotic stimuli have no significant effect. Notably, CXCL1, IL4, TGFβ and IL-2 fail to induce CD47 expression in vitro, as assessed by ANOVA. ( f ). Additional studies suggest that the effect of TNF-α on CD47 expression persists in the presence of oxidized LDL, as occurs in the atherosclerotic plaque. ( g ). Western blotting confirms that TNF-α induces CD47 expression in vascular cells at the protein level. For gel source data, see . ( h ). Immunocytochemistry studies of HCASMCs confirm that CD47 expression is induced on the cell surface of TNF-α treated cells. TNF-α effect is assessed by co-staining for HMGB1, and antibody specificity is confirmed with isotype control and recombinant CD47 peptide quenching assays. ( i ). Multiple assays (including FACS, Taqman and immunocytochemistry studies) reveal that CD47 expression is downregulated on vascular SMCs during programmed cell death, as has previously been observed with inflammatory cells. ( j ). Confirmatory assays in cultured human coronary artery SMC reveal that TNF-α induces changes similar to those observed in murine cells , including an induction of CD47 under physiological conditions and a blunting of its expected downregulation during apoptosis. ( k ). TNF-α’s capacity to impair CD47 downregulation during programmed cell death is also observed in mouse SMCs simultaneously exposed to pro-apoptotic stimuli and oxidized LDL. ( l ). No correlation between CD47 and other candidate cytokines was observed in the BiKE biobank, further supporting a specific relationship between CD47 and TNF-α. ( m ). Representative FACS-based apoptosis panels from cells exposed to the conditions used in confirm that TNF-α suppresses efferocytosis despite increasing programmed cell death. Comparisons made by two-tailed t tests, unless otherwise specified. *** = P < 0.001, * = P < 0.05. Error bars represent the SEM.

Article Snippet: In some experiments, membranes loaded with protein were incubated with anti-CD47 Ab that had been preabsorbed with CD47 peptide (R&D systems, 1866-CD, 1:5 dilution) for 16 hours, to determine the specificity of the primary Ab.

Techniques: Expressing, Gene Expression, Luminex, Clinical Proteomics, In Vivo, Biomarker Discovery, Two Tailed Test, Cell Culture, In Vitro, Western Blot, Immunocytochemistry, Staining, Control, Recombinant

Journal: Nature

Article Title: CD47 blocking antibodies restore phagocytosis and prevent atherosclerosis

doi: 10.1038/nature18935

Figure Lengend Snippet: In vivo serological data and additional in silico and bioinformatic data ( a ). Complete serological studies (including blood count, liver function studies, basic metabolic panel, and fasting glucose) from the 4 week apoE −/− -AngII atherosclerosis model indicate that anti-CD47 Ab induces a significant reduction in hemoglobin and compensatory reticulocytosis, consistent with prior reports 4 , 7 . The erythrophagocytosis of senescent RBCs appears to be self-limited, and no anemia was observed in the chronic atherosclerosis model or the reduced dose model (P = 0.54 and 0.57, respectively). No significant difference in any other serum marker is observed except for an increase in serum creatinine, which does not deviate outside of the reference range. Metabolic parameters and leukocyte differential data from the 12 week chronic atherosclerosis model are displayed at the bottom of the table. ( b ). Additional Upstream Regulator Analysis (URA) bioinformatic analyses of the Cytoscape data displayed in Extended Data Figure 7a performed within the Ingenuity Pathway Analysis (IPA) software identifies a number of TNF-α related factors (indicated in red) which are predicted to mediate transcriptional regulatory roles in the gene network shown in that panel. P-values were determined from Fisher’s Exact Test by comparing overlap of co-expressed genes with known upstream regulators from the Ingenuity Knowledge Base. ( c ). Several additional DAVID -based bioinformatics analyses including ( KEGG , SMART , PANTHER and GO analyses) confirm the association between CD47 and inflammatory signaling related to the TNF-α pathway (indicated in red). Blue panels indicate the –logp10 value for each identified factor. ( d ). Transcription factor binding site prediction algorithms identify several putative NFKB family binding sites within the CD47 promoter, as displayed in Extended Data Figure 8a . ( d ). List of primers used in this study.

Article Snippet: In some experiments, membranes loaded with protein were incubated with anti-CD47 Ab that had been preabsorbed with CD47 peptide (R&D systems, 1866-CD, 1:5 dilution) for 16 hours, to determine the specificity of the primary Ab.

Techniques: In Vivo, In Silico, Marker, Software, Binding Assay

Journal: EMBO reports

Article Title: CD47-amyloid-β-CD74 signaling triggers adaptive immunosuppression in sepsis.

doi: 10.1038/s44319-025-00442-4

Figure Lengend Snippet: Figure 5. CD47 is a potential mediator of adaptive immunosuppression in subjects with sepsis.

Article Snippet: Cat # BAA-1706 FITC-conjugated Escherichia coli Prof. Hao Yang, Sichuan University, China N/A Jurkat cell line (Clone E6-1) Pricella Cat # CL-0129 Antibodies Anti-mouse CD47 (IAP) (in vivo blockade, clone MIAP301) BioXcell Cat #BE0270 Elenbecestat (BACE1 inhibitor E2609) Selleck Cat #s8600 Anti-CD3 BD Bioscience Cat # 557984 and # 746368 Hamster IgG2 λ isotype BD Bioscience Cat # 557985 Anti-CD19 BD Bioscience Cat # 557398 and # 753680 Rat IgG2a κ isotype control BD Bioscience Cat # 553929 Anti-CD4 BD Bioscience Cat # 563151 Anti-CD8 BD Bioscience Cat # 551162 Anti-CD45 BD Bioscience Cat # 557659 Anti-CD47 BD Bioscience Cat # 563584 Anti-CD11b BD Bioscience Cat #.557397 Anti-Ly6G BD Bioscience Cat # 560601 Anti-Ly6C BD Bioscience Cat # 563011 Anti-MHC II BD Bioscience Cat # 563415 Anti-Mouse CD74 BD Bioscience Cat # 555317 APP Rabbit mAb ABclonal Cat # No. A17911 Mouse anti-rabbit IgG (conformationspecific) (L27A9) mAb (HRP Conjugate) CST Cat # 5127S Rabbit anti-mouse IgG (light chain-specific) (D3V2A) mAb (HRP Conjugate) CST Cat # 5800S Oligonucleotides and other sequence-based reagents PrimeScriptTM RT reagent kit with gDNA eraser (Perfect Real Time) TAKARA Cat # RR047Q iTaqTM Universal SYBR® Green Supermix Bio-Rad Cat # 1725124 HiScript II Q RT SuperMix for qPCR Vazyme Cat # R222-01 QX200TM ddPCRTM EvaGreen Supermix Bio-Rad Cat # 1864033 Primers (M. musculus) 18S This study F: GCAATTATTCCCCATGAACG R: GGCCTCACTAAACCATCCAA © The Author(s) EMBO reports 15 D ow nloaded from https://w w w .em bopress.org on M ay 24, 2025 from IP 2400:1a00:b030:72c5:89b6:57f4:2675:97ac.

Techniques:

Journal: EMBO reports

Article Title: CD47-amyloid-β-CD74 signaling triggers adaptive immunosuppression in sepsis.

doi: 10.1038/s44319-025-00442-4

Figure Lengend Snippet: Figure 7. CD47 induces the production of amyloid-β, which leads to B-cell suppression.

Article Snippet: Cat # BAA-1706 FITC-conjugated Escherichia coli Prof. Hao Yang, Sichuan University, China N/A Jurkat cell line (Clone E6-1) Pricella Cat # CL-0129 Antibodies Anti-mouse CD47 (IAP) (in vivo blockade, clone MIAP301) BioXcell Cat #BE0270 Elenbecestat (BACE1 inhibitor E2609) Selleck Cat #s8600 Anti-CD3 BD Bioscience Cat # 557984 and # 746368 Hamster IgG2 λ isotype BD Bioscience Cat # 557985 Anti-CD19 BD Bioscience Cat # 557398 and # 753680 Rat IgG2a κ isotype control BD Bioscience Cat # 553929 Anti-CD4 BD Bioscience Cat # 563151 Anti-CD8 BD Bioscience Cat # 551162 Anti-CD45 BD Bioscience Cat # 557659 Anti-CD47 BD Bioscience Cat # 563584 Anti-CD11b BD Bioscience Cat #.557397 Anti-Ly6G BD Bioscience Cat # 560601 Anti-Ly6C BD Bioscience Cat # 563011 Anti-MHC II BD Bioscience Cat # 563415 Anti-Mouse CD74 BD Bioscience Cat # 555317 APP Rabbit mAb ABclonal Cat # No. A17911 Mouse anti-rabbit IgG (conformationspecific) (L27A9) mAb (HRP Conjugate) CST Cat # 5127S Rabbit anti-mouse IgG (light chain-specific) (D3V2A) mAb (HRP Conjugate) CST Cat # 5800S Oligonucleotides and other sequence-based reagents PrimeScriptTM RT reagent kit with gDNA eraser (Perfect Real Time) TAKARA Cat # RR047Q iTaqTM Universal SYBR® Green Supermix Bio-Rad Cat # 1725124 HiScript II Q RT SuperMix for qPCR Vazyme Cat # R222-01 QX200TM ddPCRTM EvaGreen Supermix Bio-Rad Cat # 1864033 Primers (M. musculus) 18S This study F: GCAATTATTCCCCATGAACG R: GGCCTCACTAAACCATCCAA © The Author(s) EMBO reports 15 D ow nloaded from https://w w w .em bopress.org on M ay 24, 2025 from IP 2400:1a00:b030:72c5:89b6:57f4:2675:97ac.

Techniques:

Journal: bioRxiv

Article Title: EV trace : tracing extracellular vesicles-associated proteins in recipient cells using stable isotope labeling

doi: 10.1101/2025.11.23.690082

Figure Lengend Snippet: ( A ) Distribution of the amount of clusters (indicative of EVs) per size range (nm, depicting the diameter of the clusters) detected using the different staining panels (black circle, Integrin-β1+WGA; blue square, Integrin-β1+GFRP78; red triangle, CD47+GRP78). ( B ) Representative images of individual EVs that were enriched in either one (left, right) or two (middle) of the indicated markers: WGA (green), integrin-β1 (magenta), GRP78 (cyan), CD47 (yellow). Each horizontal row represents one of the three staining panels. White scale bars indicate 200 nm. ( C ) The percentage of EVs (of all clusters detected in each staining panel as in A) that are single or double positive for indicated markers. Bars are colored to indicate markers: light grey, WGA; blue horizontal stripes, integrin-β1; dark grey, GRP78; red vertical stripes, CD47. ( D ) Graphical summary of the detected PCa EV subpopulations and in which cell types these markers were traced (see ). Colors indicating the proteins are similar as in C. A and C show mean±SEM of 3 fields of view. WGA, Wheat Germ Agglutinin

Article Snippet: Unconjugated integrin-β1 antibody (clone P5D2, Santa Cruz Biotechnology, Dallas, TX, USA), CD47 antibody (clone B6.H12, InVivo MAb), or mouse IgG1 isotype control (clone P3.6.2.8.1, eBioscience, Invitrogen) were labeled with mouse IgG1 targeting nanobodies (VHH-AlexaFluor568, VHH-AlexaFluor647, Proteintech, Rosemont, IL, USA).

Techniques: Staining

Journal: Oncoimmunology

Article Title: Bendamustine with total body irradiation conditioning yields tolerant T-cells while preserving T-cell-dependent graft-versus-leukemia

doi: 10.1080/2162402X.2020.1758011

Figure Lengend Snippet: BEN-TBI does not result in appreciable donor T-cell phenotypic differences post-transplant when compared to CY-TBI. (a–c) BALB/c recipient mice received 40 mg/kg BEN iv or 200 mg/kg CY ip on day −2, 400 cGy TBI on day −1, and 10 7 TCD-BM from naïve C57BL/6 mice with 3 × 10 6 CellTrace Violet-stained tT from naïve BoyJ mice on day 0. Blood and spleen were collected on day +3. (a) % donor T-cells (CD45.1+) was determined by flow cytometry. Using CBCs determined by HemaVet analysis, absolute number of donor T-cells was calculated. (b) After gating on CD45.1+ cells (representing donor T-cells), CellTrace Violet dilution was analyzed using ModFit software to determine proliferation index. Representative CellTrace Violet dilution is shown. (c) Within the CD45.1+ gate, cells were stratified by CellTrace high (non- proliferative) and CellTrace low (proliferative) and CD25 and CD47 expression were analyzed by flow cytometry. Pooled data from 2 experiments with line at mean are shown, n = 6–7 mice/group. * p < .05 , ** p < .01 . (d-g) BALB/c recipient mice received 40 mg/kg BEN iv or 200 mg/kg CY ip on day −2, 400 cGy TBI on day −1, and 10 7 BM with 3 × 10 6 SC from naïve C57BL/6 mice on day 0. Peripheral blood was collected on days +7, +14, +21, +35, and +70 and stained for CD8, CD4, Tbet, GATA3, RORγt, CD134, CD278, PD-1, TIM3, CTLA-4, and CD272. CBCs were determined and used to calculate absolute cell numbers. Average absolute numbers of cells per μL of blood are shown with SEM. Representative flow plots from day +7 with fluorescence minus one (FMO) controls are shown (e). (d) Pooled data from 4 experiments are shown, n = 19 mice/group. (e-g) Pooled data from 2 experiments are shown, n = 10 mice/group. ** p < .01.

Article Snippet: Antibodies used were anti-mouse H2kb PerCP-eFluor710 (clone AF6-88.5.5.3; 46–5958), CD8α PE-Cy7 (53–6.7; 25–0081), CD4 APC (RM4-5; 50-148-54), FoxP3 APC (FJK-16s; 17–5773), CD45.1 APC (A20; 17–0453), GATA3 PE-Cy7 (TWAJ; 25–9966), CD134 PE-Cy7 (OX-86; 25–1341), FoxP3 PE (150D/E4; 12–4774), CD69 PE-Cy5 (H1.2F3; 15–0691), RORγt APC (AFKJS-9; 17–6988), IFN gamma PE (XMG1.2, 12–7311) (Thermo Fisher Scientific), CD45.1 PE-CF594 (A20; 562452), CD3ε PE-CF594 (145–2 C11; 562286), CD44 BB515 (IM7; 565941), CD44 BV510 (IM7; 563114) (BD Biosciences), CD47 PE-Vio770 (REA170; 130-102-383), TIM-3 VioBright FITC (REA602; 130-109-449), TIM-3 PE (REA602; 130-118-563), CD278 VioGreen (REA192; 130-100-739), CD272 PE (REA224; 130-102-689), CD4 APC-Vio770 (GK1.5; 130-102-786), CD4 VioGreen (GK1.5; 130-102-444) (Miltenyi Biotec), Tbet PE-Dazzle594 (4B10; 644828), CTLA-4 PE-Dazzle594 (UC10-4B9; 106318), CD8α Brilliant Violet 421 (53–6.7; 100738), CCR7 PE-Cy5 (4B12; 120114), PD-1 APC (29F.1A12; 135210), CD25 AlexaFluor700 (PC61; 102024), and TNF-α Brilliant Violet 510 (MP6-XT22, 506339) (Biolegend).

Techniques: Staining, Flow Cytometry, Software, Expressing, Fluorescence

Journal: Scientific reports

Article Title: Preclinical pharmacology characterization of HX009, a novel PD1 x CD47 Bi-specific antibody.

doi: 10.1038/s41598-024-79865-3

Figure Lengend Snippet: Fig. 1. HX009 structure and in vitro characterization. (A) Molecular structure of HX009: 2 × 2 symmetric BsAb molecule; (B) HX009 binding to the recombinant CD47 proteins of different species including human, cynomolgus monkey (upper) and mouse (lower), binding EC50 (half maximal effective concentration) were determined per four-parameter equation fitting curves; (C) competitive binding to CD47 single-positive (upper panel) or CD47-PD1 double positive (lower panel) cells by HX009. Labeled B6H12 (anti-CD47) was competed out by SIRPα-Fc, but not by HX009 (weakened binding) in single-positive cell assay, while it was competed out in double-positive cell assays by both SIPRα-Fc and HX009. (D) T-cell activation luciferase report assays: upper panel: HX009 had enhanced T-cell activation (cis-binding) over HX008 (4X), whereas the enhancement is diminished by an anti-SIRPα neutralizing antibody but not by CD47-Fc (soluble CD47). Lower panel: there was no enhancement of T-cell activation by HX008 and SIRPα-Fc combo treatment due to trans-binding.

Article Snippet: By coupling the 7.5 μg/mL of HX009 antibody on the chip surface, the recombinant human (Atagenix), cynomolgus monkey (Acrobiosystems), mouse (Sinobiological) and rat (Sinobiological) CD47 proteins, at serial loading concentrations from 2 to 128 nM (two-fold dilution), or the recombinant human (Atagenix), cynomolgus monkey (Sinobiological), mouse (Sinobiological) and rat (Sinobiological) PD1 proteins at serial loading concentrations from 1 to 64 nM (two-fold dilution), flowed through the chip surface, a binding of 200-s to reach the target level above 770 RU, and a 20-min dissociation time with 10 mM of Glycine pH 1.7.

Techniques: In Vitro, Binding Assay, Recombinant, Concentration Assay, Labeling, Activation Assay, Luciferase

Journal: Scientific reports

Article Title: Preclinical pharmacology characterization of HX009, a novel PD1 x CD47 Bi-specific antibody.

doi: 10.1038/s41598-024-79865-3

Figure Lengend Snippet: Fig. 3. HX009 anti-tumor pharmacology studies in preclinical cancer models. (A) Pharmacology evaluation of HX009 in a humanized MC38-huCD47 mouse colon cancer model in huPD1-HuGEMM mice; (B) Pharmacology evaluation of HX009 in a humanized MC38-huCD47 mouse colon cancer model in huPD1 × huPD-L1 × huCD47 × huSIRPα-HuGEMM model; (C) Pharmacology evaluation of HX009 in three AML-PDX models as shown in the figures. Columns from Left to right: Leukemic burden was measured as percentage of human CD45+ cells in peripheral blood; survival was displayed as in Caplan-Meier plot; Leukemic loads in different organs at the termination, as % of human CD45+. SP spleen, BM bone marrow, PB peripheral blood. Bottom: The differential expressions of CD47 per IHC and RNAseq in three AML-PDX models are shown in the bottom table. Graphs in A-D showed mean tumor volume ± standard error of the mean (SEM). Significance was calculated using one-way ANOVA with post-hoc comparisons or Welch’s t- test between treatment groups and vehicle group. ns, no significance; *p < 0.05; **p < 0.01; ***p < 0.001. (D) Correlation of OX40 mRNA levels with HX009 anti-lymphoma activity represented by TGI (tumor growth inhibition) in DLBCL-PDX trial.

Article Snippet: By coupling the 7.5 μg/mL of HX009 antibody on the chip surface, the recombinant human (Atagenix), cynomolgus monkey (Acrobiosystems), mouse (Sinobiological) and rat (Sinobiological) CD47 proteins, at serial loading concentrations from 2 to 128 nM (two-fold dilution), or the recombinant human (Atagenix), cynomolgus monkey (Sinobiological), mouse (Sinobiological) and rat (Sinobiological) PD1 proteins at serial loading concentrations from 1 to 64 nM (two-fold dilution), flowed through the chip surface, a binding of 200-s to reach the target level above 770 RU, and a 20-min dissociation time with 10 mM of Glycine pH 1.7.

Techniques: Activity Assay, Inhibition

Journal: Cell Regeneration

Article Title: Engineered macrophages: an “Intelligent Repair” cellular machine for heart injury

doi: 10.1186/s13619-024-00209-7

Figure Lengend Snippet: Summary of the strategy of macrophage therapy for myocardial injury

Article Snippet: , Primary cells , Mouse , Biomimetic nanomaterials inhibit CD47-SIRPα axis , Phagocytosis ↑ , Gao et al. ( , ) .

Techniques: Membrane, Functional Assay, Inhibition, Knock-Out

Journal: Cell

Article Title: A membrane-less organelle associated with the endoplasmic reticulum enables 3′UTR-mediated protein-protein interactions

doi: 10.1016/j.cell.2018.10.007

Figure Lengend Snippet: (A) The interaction between SET and CD47-LU protein is 3′UTR-dependent, as CD47-SU does not interact with SET. It is unknown how SET is transferred from the 3′UTR to the protein.

Article Snippet: To detect endogenous CD47 surface expression, cells were incubated with PerCP-Cy5.5 mouse anti-CD47 (BD Biosciences, 561261) or Alexa Fluor 647 mouse anti-CD47 (BD Biosciences, 561249) in FACS buffer A for 20 min at 4°C and then washed twice with FACS buffer A.

Techniques:

Journal: Cell

Article Title: A membrane-less organelle associated with the endoplasmic reticulum enables 3′UTR-mediated protein-protein interactions

doi: 10.1016/j.cell.2018.10.007

Figure Lengend Snippet: KEY RESOURCES TABLE

Article Snippet: To detect endogenous CD47 surface expression, cells were incubated with PerCP-Cy5.5 mouse anti-CD47 (BD Biosciences, 561261) or Alexa Fluor 647 mouse anti-CD47 (BD Biosciences, 561249) in FACS buffer A for 20 min at 4°C and then washed twice with FACS buffer A.

Techniques: Recombinant, Blocking Assay, Protease Inhibitor, Mutagenesis, Plasmid Preparation, Luciferase, shRNA, Software

Journal: Cell

Article Title: A membrane-less organelle associated with the endoplasmic reticulum enables 3′UTR-mediated protein-protein interactions

doi: 10.1016/j.cell.2018.10.007

Figure Lengend Snippet: (A) Co-IP of endogenous SET using GFP-Trap after transfection of GFP-CD47-LU into HeLa cells stably expressing the indicated shRNAs. 2.5 % of input was loaded. TUBULIN was used as additional loading control. shRNA Ctrl, control shRNA.

Article Snippet: To detect endogenous CD47 surface expression, cells were incubated with PerCP-Cy5.5 mouse anti-CD47 (BD Biosciences, 561261) or Alexa Fluor 647 mouse anti-CD47 (BD Biosciences, 561249) in FACS buffer A for 20 min at 4°C and then washed twice with FACS buffer A.

Techniques: Co-Immunoprecipitation Assay, Transfection, Stable Transfection, Expressing, shRNA

Journal: Cell

Article Title: A membrane-less organelle associated with the endoplasmic reticulum enables 3′UTR-mediated protein-protein interactions

doi: 10.1016/j.cell.2018.10.007

Figure Lengend Snippet: (A) FACS analysis of surface and total GFP in HeLa cells after transfection of GFP-CD47-LU together with mC (grey) or mC-SET (green). Representative plots are shown.

Article Snippet: To detect endogenous CD47 surface expression, cells were incubated with PerCP-Cy5.5 mouse anti-CD47 (BD Biosciences, 561261) or Alexa Fluor 647 mouse anti-CD47 (BD Biosciences, 561249) in FACS buffer A for 20 min at 4°C and then washed twice with FACS buffer A.

Techniques: Transfection

Journal: Journal of the American Heart Association: Cardiovascular and Cerebrovascular Disease

Article Title: Cardiac CD47 Drives Left Ventricular Heart Failure Through Ca 2+ ‐CaMKII‐Regulated Induction of HDAC3

doi: 10.1161/JAHA.113.000670

Figure Lengend Snippet: TSP1‐CD47 signaling is up‐regulated in LVHF. Western immunoblot analysis of protein expression (A and B) and mRNA transcript (C and D) levels of TSP1 and CD47 left ventricle samples from wild‐type (WT) and CD47 ( −/− ) null mice pre‐ and 4 weeks post‐TAC. Data are presented as the mean (±SEM; n=3 to 7 animals/group). *=statistically significant difference ( P <0.05), compared to control and WT and WT TAC. LVHF indicates left ventricular heart failure; TAC, transverse aortic constriction; TSP1, thrombospondin 1.

Article Snippet: The following primers sequences from Applied Biosystems were employed: mouse TSP1 (Mm01335418_m1); mouse CD47 (Mm00495005_m1); mouse HPRT1 (Mm00446968_m1); human TSP1 (Hs00962908_m1); human CD47 (Hs00179953_m1); and human HPRT1 (Hs99999909_m1).

Techniques: Western Blot, Expressing, Control

Journal: Journal of the American Heart Association: Cardiovascular and Cerebrovascular Disease

Article Title: Cardiac CD47 Drives Left Ventricular Heart Failure Through Ca 2+ ‐CaMKII‐Regulated Induction of HDAC3

doi: 10.1161/JAHA.113.000670

Figure Lengend Snippet: CD47 promotes LVHF. A, H&E staining of murine left ventricle tissue sections from wild‐type (WT) and CD47 ( −/− ) null mice 4 weeks post‐TAC and controls. Cell‐size quantification is presented as the mean (±SEM) of analysis of 4 to 5 slides per animal sample, 10 random hpf per slide, 4 to 5 animals per treatment group. *=statistically significant difference ( P <0.05), compared to WT; #=statistically significant difference ( P <0.05), compared to WT TAC. Representative images are presented (original magnification, ×40). B, Immunofluorescence staining of murine left ventricle tissue sections 4 weeks post‐TAC or control. DAPI, collagen I, and phalloidin colored blue, green, and red, respectively. Fibrosis is calculated as intensity of fluorescence and is presented as the mean (±SEM) of analysis of 3 to 5 slides per animal sample, 10 random hpf per slide, 4 to 7 animals per treatment group. *=statistically significant difference ( P <0.05), compared to WT; #=statistically significant difference ( P <0.05), compared to WT TAC. Representative images are presented (original magnification, ×40). C, Left ventricle weights (LVW) and LV to body weight from animals 4 weeks post‐TAC or controls. Data are presented as the mean (±SEM) of n=7 to 12 animals per group. *=statistically significant difference ( P <0.05), compared to WT; #=statistically significant difference ( P <0.05), compared to WT TAC. D, Assessment by open‐chest pressure volume loop analysis of cardiac output, contractility, and ventricular stiffness (dp/dt min) of animals 4 weeks post‐TAC or control. Data are presented as the mean (±SEM) of n=7 to 12 animals/group. *=statistically significant difference ( P <0.05), compared to WT; #=statistically significant difference ( P <0.05), compared to WT TAC. E, Representative pressure volume tracings are shown from age‐matched male WT and CD47‐null mice at baseline and post‐TAC. F, Western immunoblot analysis of TSP1 expression in left ventricular samples from CD47 null mice 4 weeks post‐TAC or control. Data are presented as the mean (±SEM; n=3 to 6 animals per group). G, TUNEL staining of murine left ventricle tissue sections from control WT and CD47‐null animals (CTRL) and 4 weeks post‐TAC. Data are presented as the mean (±SEM) of the ratio of TUNEL positive cells over total nuclei from analysis of 4 to 5 slides per animal sample, 10 random hpf per slide, 3 to 4 animals per treatment group. *=statistically significant difference ( P <0.05), compared to WT TAC. DAPI indicates 4',6‐diamidino‐2‐phenylindole; H&E, hematoxylin and eosin; LVHF, left ventricular heart failure; TAC, transverse aortic constriction; TSP1, thrombospondin 1; TUNEL, terminal deoxynucleotidyl transferase dUTP nick end labeling.

Article Snippet: The following primers sequences from Applied Biosystems were employed: mouse TSP1 (Mm01335418_m1); mouse CD47 (Mm00495005_m1); mouse HPRT1 (Mm00446968_m1); human TSP1 (Hs00962908_m1); human CD47 (Hs00179953_m1); and human HPRT1 (Hs99999909_m1).

Techniques: Staining, Immunofluorescence, Control, Fluorescence, Western Blot, Expressing, TUNEL Assay

Journal: Journal of the American Heart Association: Cardiovascular and Cerebrovascular Disease

Article Title: Cardiac CD47 Drives Left Ventricular Heart Failure Through Ca 2+ ‐CaMKII‐Regulated Induction of HDAC3

doi: 10.1161/JAHA.113.000670

Figure Lengend Snippet: CD47 up‐regulates HDAC 3 in LVHF. A, Western immunoblot analysis of HDAC3 and phosphorylated (p‐)HDAC3 expression in LV samples from wild‐type (WT) and CD47 ( −/− ) null animals 4 weeks post‐TAC or control. Densitometry is presented as the mean (±SEM) of n=6 to 9 animals per group. *=statistically significant difference ( P <0.05), compared to WT; #=statistically significant difference ( P <0.05), compared to WT TAC. B, Western immunoblot analysis of HDAC3 and phosphorylated HDAC3 (p‐HDAC3) expression in left ventricular samples from end‐stage nonischemic LVHF (n=4) and control (n=5) patients. Densitometry is presented as the mean (±SEM). *=statistically significant difference ( P <0.05), compared to control. C, Rat neonatal cardiac myocytes (RNCMs) were treated with the TSP1‐based CD47‐activating peptide, 7N3 (10 μmol/L), for the indicated time points (h=hours) or (D) angiotensin II (Ang II; 10 μmol/L for 48 hours)±a CD47 antagonist antibody (Ab; clone OX101, 1 μg/mL) and Western immunoblot analysis of HDAC3 protein expression performed on cell lysates. Representative blots are shown. Densitometry is presented as the mean (±SEM) of n=3 experiments. *=statistically significant difference ( P <0.05), compared to untreated. E, RNCMs were treated with a HDAC3 or control (CTRL) morpholino oligonucleotide (20 mmol/L)±peptide 7N3 (10 μmol/L) for 48 hours and cell size assessed. Representative images are presented (original magnification, ×40). Data are presented as the mean (±SEM) of 4 separate experiments. *=statistically significant difference ( P <0.05), compared to CTRL morpholino; #=statistically significant difference ( P <0.05), compared to CTRL morpholino+7N3. F, RNCMs were treated with the CD47‐activating peptide, 7N3 (10 μmol/L)±DETA‐NO (10 μmol/L), for 3 hours, and Western immunoblot analysis of total and phosphorylated HDAC3 (p‐HDAC3) protein expression was performed on cell lysates. Representative blots are shown. Densitometry is presented as the mean (±SEM) of n=3 experiments. HDAC indicates histone deacetylases; LVHF, left ventricular heart failure; TAC, transverse aortic constriction; TSP1, thrombospondin 1.

Article Snippet: The following primers sequences from Applied Biosystems were employed: mouse TSP1 (Mm01335418_m1); mouse CD47 (Mm00495005_m1); mouse HPRT1 (Mm00446968_m1); human TSP1 (Hs00962908_m1); human CD47 (Hs00179953_m1); and human HPRT1 (Hs99999909_m1).

Techniques: Western Blot, Expressing, Control

Journal: Journal of the American Heart Association: Cardiovascular and Cerebrovascular Disease

Article Title: Cardiac CD47 Drives Left Ventricular Heart Failure Through Ca 2+ ‐CaMKII‐Regulated Induction of HDAC3

doi: 10.1161/JAHA.113.000670

Figure Lengend Snippet: Activated CD47 promotes decreased cytosolic and increased nuclear HDAC3 expression. Western immunoblots of nuclear (A) and cytosolic (B) HDAC3 expression in LV tissue samples from wild‐type (WT) and CD47 ( −/− ) null animals 4 weeks post‐TAC or control. Densitometry is presented as the mean (±SEM) of n=6 to 9 animals per group. *=statistically significant difference ( P <0.05), compared to WT; #=statistically significant difference ( P <0.05), compared to WT TAC. Rat neonatal cardiac myocytes (RNCMs) were treated with peptide 7N3 (10 μmol/L) for 3 hours, and Western immunoblot analysis of cytosolic and nuclear total HDAC3 (t‐HDAC3) (C) and cytosolic and nuclear phosphorylated HDAC3 (p‐HDAC3) (D) protein expression was performed. Densitometry is presented as the mean (±SEM) of n=6 to 9 separate experiments. *=statistically significant difference ( P <0.05), compared to control. E, Immunofluorescence staining of RNCMs treated with peptide 7N3 (10 μmol/L) for 3 and 24 hours, respectively. DAPI, total HDAC3, and p‐HDAC3, and actin are colored blue, red, and green, respectively. Stained area of fluorescence is presented as the mean (±SEM) of analysis of multiple (>3) regions of interest (ROIs) per culture dish with n=a minimum of 4 cells per ROI. Fluorescent images were captured with an Olympus Fluoview 1000 confocal microscope (software version 2.01; Olympus America Inc., Bethlehem, PA) and analyzed with NIS Elements (version 4.13; Nikon Instruments, Inc., Melville, NY) and calculated as total red (p‐ or t‐HDAC3) area in nuclei/total red (p‐ or t‐HDAC3) area in cytosol. *=statistically significant difference ( P <0.05), compared to control. F, Western immunoblots of nuclear and cytosolic HDAC3 expression in LV tissue samples from WT mice±a CD47 antagonist antibody (Ab) (clone 301, 0.4 μg/g body weight IP weekly for 3 weeks). Animals underwent TAC for 1 week before beginning Ab treatment. Densitometry is presented as the mean (±SEM) of n=6 to 9 animals per group. *=statistically significant difference ( P <0.05), compared to WT; #=statistically significant difference ( P <0.05), compared to WT TAC. HDAC indicates histone deacetylases; LV, left ventricle; TAC, transverse aortic constriction.

Article Snippet: The following primers sequences from Applied Biosystems were employed: mouse TSP1 (Mm01335418_m1); mouse CD47 (Mm00495005_m1); mouse HPRT1 (Mm00446968_m1); human TSP1 (Hs00962908_m1); human CD47 (Hs00179953_m1); and human HPRT1 (Hs99999909_m1).

Techniques: Expressing, Western Blot, Control, Immunofluorescence, Staining, Fluorescence, Microscopy, Software

Journal: Journal of the American Heart Association: Cardiovascular and Cerebrovascular Disease

Article Title: Cardiac CD47 Drives Left Ventricular Heart Failure Through Ca 2+ ‐CaMKII‐Regulated Induction of HDAC3

doi: 10.1161/JAHA.113.000670

Figure Lengend Snippet: Gene suppression of HDAC3 mitigates LVHF. A, H&E staining of murine left ventricle tissue sections 4 weeks post‐TAC or post‐TAC followed 1 week later with HDAC3 morpholino treatment. Cell‐size quantification is presented as the mean (±SEM) of analysis of 4 to 5 slides per animal sample, 10 random hpf per slide, 3 to 4 animals per treatment group. *=statistically significant difference ( P <0.05), compared to wild‐type (WT); #=statistically significant difference ( P <0.05), compared to WT TAC. Representative images are presented (original magnification, ×40). B, Immunofluorescence staining of murine left ventricle tissue sections 4 weeks post‐TAC or post‐TAC followed 1 week later with HDAC3 morpholino treatment. DAPI, collagen I, and phalloidin are colored blue, green, and red, respectively. Fibrosis is calculated as intensity of fluorescence and is presented as the mean (±SEM) of analysis of 4 to 5 slides per animal sample, 10 random hpf per slide, 4 to 8 animals per treatment group. *=statistically significant difference ( P <0.05), compared to WT; #=statistically significant difference ( P <0.05), compared to WT TAC. Representative images are presented (original magnification, ×40). C, Assessment by open‐chest pressure volume loop analysis of cardiac output, contractility, and ventricular stiffness (dp/dt min) of animals from the indicated groups. Data are presented as the mean (±SEM) of n=4 to 12 animals/group. *=statistically significant difference ( P <0.05), compared to WT and WT TAC, respectively; #=statistically significant difference ( P <0.05), compared to WT TAC. D, Left ventricle weights alone and normalized to body weight from animals in treatment groups as in A. Data are presented as the mean (±SEM) of n=4 to 12 animals/group. *=statistically significant difference ( P <0.05), compared to WT; #=statistically significant difference ( P <0.05), compared to WT TAC. E, Representative pressure volume tracings are shown from WT, WT TAC, and WT TAC+HDAC3 morpholino‐treated mice. Western immunoblot analysis of HDAC3 (F), TSP1 (G), and CD47 (H) protein expression in LV samples from animals in the indicated groups. Densitometry is presented as the mean (±SEM) of n=4 to 9 animals/group. *=statistically significant difference ( P <0.05), compared to control; #=statistically significant difference ( P <0.05), compared to WT TAC. I, Rat neonatal cardiac myocytes were treated with a CD47 antibody (Ab; clone OX101, 1 mg/mL)±peptide 7N3 (10 μmol/L) for 48 hours, and expression of total HDAC3 and phosphorylated HDAC3 (p‐HDAC3) by Western immunoblot was determined. Densitometry is presented as the mean (±SEM) of 3 separate experiments. *=statistically significant difference ( P <0.05), compared to 7N3+CD47 Ab treated. J, TUNEL staining of murine LV tissue sections from WT and 4 weeks post‐TAC animals with and without HDAC3 morpholino treatment. Data are presented as the mean (±SEM) of the ratio of TUNEL‐positive cells over total nuclei from analysis of 4 to 5 slides per animal sample, 10 random hpf per slide, 3 to 4 animals per treatment group. *=statistically significant difference ( P <0.05), compared to WT TAC. DAPI indicates 4',6‐diamidino‐2‐phenylindole; HDAC, histone deacetylase; H&E, hematoxylin and eosin; LVHF, left ventricular heart failure; TAC, transverse aortic constriction; TSP1, thrombospondin‐1; TUNEL, terminal deoxynucleotidyl transferase dUTP nick end labeling.

Article Snippet: The following primers sequences from Applied Biosystems were employed: mouse TSP1 (Mm01335418_m1); mouse CD47 (Mm00495005_m1); mouse HPRT1 (Mm00446968_m1); human TSP1 (Hs00962908_m1); human CD47 (Hs00179953_m1); and human HPRT1 (Hs99999909_m1).

Techniques: Staining, Immunofluorescence, Fluorescence, Western Blot, Expressing, Control, TUNEL Assay, Histone Deacetylase Assay

Journal: Journal of the American Heart Association: Cardiovascular and Cerebrovascular Disease

Article Title: Cardiac CD47 Drives Left Ventricular Heart Failure Through Ca 2+ ‐CaMKII‐Regulated Induction of HDAC3

doi: 10.1161/JAHA.113.000670

Figure Lengend Snippet: Activated CD47 increases CaMKII expression to increase HDAC3. A, Western immunoblot analysis of CaMKII and phosphorylated CaMKII (p‐CaMKII) protein expression in LV tissue samples from patients with nonischemic end‐stage LVHF (n=4) and normal controls (n=5). Densitometry is presented as the mean (±SEM). *=statistically significant difference ( P <0.05), compared to control. B, Western immunoblot analysis of CaMKII and p‐CaMKII protein expression in left ventricular tissue samples from wild‐type (WT) and CD47‐null animals 4 weeks post‐TAC or controls. Densitometry is presented as the mean (±SEM) of n=6 to 9 animals/group. *=statistically significant difference ( P <0.05), compared to control. C, Rat neonatal cardiac myocytes (RNCMs) were treated with peptide 7N3 (10 μmol/L) for the indicated time points, and Western immunoblot analysis of p‐CaMKII and total CaMKII protein expression was performed. Densitometry is presented as the mean (±SEM) of 3 separate experiments. *=statistically significant difference ( P <0.05), compared to control. RNCMs were treated with either a CD47 antibody (D; OX101, 1 mg/mL for 48 hours) or the specific CaKMII inhibitor, AIP (E; 10 nmol/L, 30 minutes)±peptide 7N3 (10 μmol/L, 3 hours), and Western immunoblot analysis of p‐CaMKII, HDAC3, and phosphorylated HDCA3 (p‐HDAC3) was performed. Densitometry is presented as the mean (±SEM) of 3 separate experiments. *=statistically significant difference ( P <0.05), compared to 7N3+CD47 Ab treated and 7N3+AIP. F, RNCMs were loaded with the calcium indicator, Fluo‐4 AM, treated with peptide 7N3 (10 μmol/L)±tetracaine (0.5 mmol/L) for the indicated time points, and images were acquired. Fluorescent intensity was determined and results are expressed as the mean±(SEM) from the analysis of cells within a minimum of 7 to 11 regions of interest per culture dish per treatment group. Significant difference ( P <0.05) between treatment groups 7N3, compared to 7N3+tetracaine, from 17 through 30 minutes. G, Western immunoblot analysis of total and phosphorylated PLB (p‐PLB) protein expression in left ventricular tissue samples from WT and CD47‐null animals 4 weeks post‐TAC or controls. Densitometry is presented as the mean (±SEM) of n=4 to 6 animals/group. *=statistically significant difference ( P <0.05), compared to control; #=statistically significant difference ( P <0.05), compared to WT TAC. AIP indicates autocamtide‐2‐related inhibitory peptide; CaMKII, calcium/calmodulin‐dependent protein kinase II; LVHF, left ventricular heart failure; TAC, transverse aortic constriction.

Article Snippet: The following primers sequences from Applied Biosystems were employed: mouse TSP1 (Mm01335418_m1); mouse CD47 (Mm00495005_m1); mouse HPRT1 (Mm00446968_m1); human TSP1 (Hs00962908_m1); human CD47 (Hs00179953_m1); and human HPRT1 (Hs99999909_m1).

Techniques: Expressing, Western Blot, Control

Journal: Journal of the American Heart Association: Cardiovascular and Cerebrovascular Disease

Article Title: Cardiac CD47 Drives Left Ventricular Heart Failure Through Ca 2+ ‐CaMKII‐Regulated Induction of HDAC3

doi: 10.1161/JAHA.113.000670

Figure Lengend Snippet: Activated CD47 promotes accumulation of autophagy markers in LVHF. A, Western immunoblot analysis of LC3 protein expression in LV tissue samples from patients with nonischemic end‐stage LVHF (n=4) and controls (n=5). Densitometry is presented as the mean of all samples (±SEM). *=statistically significant difference ( P <0.05), compared to controls. B, Western immunoblot analysis of LV LC3 protein expression in age‐matched male wild‐type (WT) C57BL/6 mice pre‐TAC and at the indicated days post‐TAC (n=3 to 4 animals in each treatment group). Densitometry is presented as the mean (±SEM). *=statistically significant difference ( P <0.05), compared to pre‐TAC. C, Densitometry of Western immunoblot analysis of LC3 protein expression in LV tissue samples from age‐matched male WT and CD47 ( −/− ) null mice 4 weeks post‐TAC or control. Densitometry is presented as the mean (±SEM) of n=6 to 9 animals/group. *=statistically significant difference ( P <0.05), compared to WT. D, Densitometry of Western immunoblot analysis of LC3, ATG5, and ATG7 protein expression in LV tissue samples from WT mice post‐TAC±an HDAC3 morpholino (7 mg/kg body weight) or (E) a CD47 antagonist antibody (Ab; clone 301, 0.4 mg/kg body weight). Densitometry is presented as the mean (±SEM) of n=4 to 9 animals/group. *=statistically significant difference ( P <0.05), compared to WT; *, #=statistically significant difference ( P <0.05), compared to WT TAC. F, Rat neonatal cardiac myocytes (RNCMs) were treated with a CD47 antagonist (clone OX101, 1 mg/mL) or control Ab, (G) AIP (10 nmol/L, 30 minutes), or (H) an HDAC3 morpholino (10 mmol/L)±peptide 7N3 (10 mmol/L), cell lysates were prepared, and Western immunblots for LC3 performed. Densitometry is presented as the mean (±SEM) of 3 separate experiments. *=statistically significant difference ( P <0.05), compared to 7N3+CD47 Ab, 7N3+AIP, and 7N3+HDAC3 morpholino, respectively. AIP indicates autocamtide‐2‐related inhibitory peptide; ATG, autophagy‐related gene; HDAC3, histone deacetylase 3; LC3, light‐chain 3; LVHF, left ventricular heart failure; TAC, transverse aortic constriction.

Article Snippet: The following primers sequences from Applied Biosystems were employed: mouse TSP1 (Mm01335418_m1); mouse CD47 (Mm00495005_m1); mouse HPRT1 (Mm00446968_m1); human TSP1 (Hs00962908_m1); human CD47 (Hs00179953_m1); and human HPRT1 (Hs99999909_m1).

Techniques: Western Blot, Expressing, Control, Histone Deacetylase Assay

Journal: Journal of the American Heart Association: Cardiovascular and Cerebrovascular Disease

Article Title: Cardiac CD47 Drives Left Ventricular Heart Failure Through Ca 2+ ‐CaMKII‐Regulated Induction of HDAC3

doi: 10.1161/JAHA.113.000670

Figure Lengend Snippet: CD47 blockade results in decreased HADC3 expression and corrects established LV HF. (A) H&E staining of murine LV tissue sections from wild‐type (WT) mice 4 weeks post‐TAC or post‐TAC followed 1 week later with a CD47 antagonist antibody (Ab; clone 301, 0.4 μg/g body weight IP) weekly for 3 weeks. Quantification of cell size is presented as the mean (±SEM) of analysis of 4 to 5 slides per animal sample, 10 random hpf per slide, 3 to 4 animals per treatment group. *=statistically significant difference ( P <0.05), compared to WT; #=statistically significant difference ( P <0.05), compared to WT TAC. Representative images are presented (original magnification, ×40). B, Immunofluorescence staining of murine left ventricle tissue sections 4 weeks post‐TAC or control as above indicated in (A). DAPI, collagen I, and phalloidin are colored blue, green, and red, respectively. Fibrosis is calculated as intensity of fluorescence and is presented as the mean (±SEM) of analysis of 3 to 5 slides pre animal sample, 10 random hpf per slide, 4 to 8 animals per treatment group. *=statistically significant difference ( P <0.05), compared to WT; #=statistically significant difference ( P <0.05), compared to WT TAC. Representative images are presented (original magnification, ×40). C, Left ventricle weight alone and normalized to body weight from animals in treatment groups as indicated in (A). Data are presented as the mean (±SEM) of n=7 to 12 animals/group. *=statistically significant difference ( P <0.05), compared to WT; #=statistically significant difference ( P <0.05), compared to WT TAC. Assessment by open‐chest pressure volume loop analysis of cardiac output, contractility, and ventricular stiffness (dp/dt min) of animals from indicated treatment groups. Data are presented as the mean (±SEM) of n=7 to 12 animals/group. *=statistically significant difference ( P <0.05), compared to WT and WT TAC, respectively; #=statistically significant difference ( P <0.05). compared to WT TAC. D, Representative pressure volume tracings from WT, WT TAC, and WT TAC+CD47 Ab‐treated mice. Western immunoblot analysis of HDAC3 (E) and CaMKII (F) protein expression in LV samples from animals in the indicated groups. Densitometry is presented as the mean (±SEM) of n=4 to 5 animals/group. *=statistically significant difference ( P <0.05), compared to WT; #=statistically significant difference ( P <0.05), compared to WT TAC. G, Rat neonatal cardiac myocytes were treated with CD47 antagonist Ab (clone OX101, 1 mg/mL) or immunoglobulin G (IgG) control antibody±peptide 7N3 (10 μmol/L) for 48 hours, and cell size was determined. Representative images are presented (original magnification, ×40). Data are presented as the mean (±SEM) of 4 separate experiments. *=statistically significant difference ( P <0.05), compared to IgG; #=statistically significant difference ( P <0.05), compared to IgG+7N3. H, TUNEL staining of murine LV tissue sections from WT and 4 weeks post‐TAC animals with and without CD47 antagonist Ab treatment. Data are presented as the mean (±SEM) of the ratio of TUNEL‐positive cells over total nuclei from analysis of 4 to 5 slides per animal sample, 10 random hpf per slide, 3 to 4 animals per treatment group. *=statistically significant difference ( P <0.05), compared to WT TAC. I, Schematic: Secreted TSP1 binds to cardiac myocyte CD47, stimulating extracellular movement of calcium through L‐type channels. This leads to ryanodine receptor (RyR2)‐mediated calcium efflux from the sarcoplasmic reticulum, activating CaMKII to up‐regulate HDAC3 and promote myocyte hypertrophy and LVHF. CaMKII indicates calcium/calmodulin‐dependent protein kinase II; DAPI indicates 4',6‐diamidino‐2‐phenylindole; HDAC3, histone deacetylases; H&E, hematoxylin and eosin; LVHF, left ventricular heart failure; TAC, transverse aortic constriction; TSP1, thrombospondin 1; TUNEL, terminal deoxynucleotidyl transferase dUTP nick end labeling.

Article Snippet: The following primers sequences from Applied Biosystems were employed: mouse TSP1 (Mm01335418_m1); mouse CD47 (Mm00495005_m1); mouse HPRT1 (Mm00446968_m1); human TSP1 (Hs00962908_m1); human CD47 (Hs00179953_m1); and human HPRT1 (Hs99999909_m1).

Techniques: Expressing, Staining, Immunofluorescence, Control, Fluorescence, Western Blot, TUNEL Assay